|
Abstract
|
Here, the interaction of three aptamers with HIV-1 protease was investigated with the help of molecular dynamics simulations. These simulations led to precise structural and energetic results. The sequencing of the considered aptamers was AP1 as the aptamer number 1: (CUUCAUUGUAACUUCUCAUAAUUUCCCGAGGCUUUUACUUUCGGGGUCCU), AP2 as the aptamer number 2: (CCGGGUCGUCCCCUACGGGGACUAAAGACUGUGUCCAACCGCCCUCGCCU), and AP3 as the aptamer number 3: (C, U, A, G and UU nucleotides of AP1 were replaced with A, G, G, A and C to yield AP3). The results of molecular dynamics simulations showed that aptamers 2 and 3 were good alternatives to interact with the protease enzyme and to control this enzyme; however, in AP2 the results were somehow improved. The results of MM-PBSA showed that although the aptamer 3 as a mutant aptamer had a good affinity with the protease enzyme, as compared to the aptamer 1, by impairing dimerization, it disrupted its structural stability and function. However, the results also indicated that the aptamer 2 could be a better inhibitor because it would cause a more severe conformational change in the structure of the enzyme.
|